IL11RA Knockout Cell Line - CD BioSciences

service-banner

IL11RA Knockout Cell Line

IL11RA Knockout Cell Line

SPL-01706

Size Price
1 Unit Online Inquiry
Description
23bp deletion
Target Information
Target Name IL-11 Receptor
Gene Abbr. IL11RA
Gene ID 3590
Full Name interleukin 11 receptor subunit alpha
Alias CRSDA
Species Human
Genomic Locus chr9:34655631
Transcript NM_001142784
WT Expression Level 5.72 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the gp130 transducing subunit in their high affinity receptors. This gene encodes the IL-11 receptor, which is a member of the hematopoietic cytokine receptor family. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of IL11RA.
Description 23bp deletion
Parental Cell Line C631
Guide RNA Sequence TCCGTGAAGCTGTGTTGTCC
PCR Primer Forward: TCTCTGACCTCTGTCTCCAGATTAT
Reverse: GACAGATAGAGAGGTGAGGATTACG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.