Online Inquiry
IL11RA Knockout Cell Line
SPL-01706
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 23bp deletion |
| Target Information | |
|---|---|
| Target Name | IL-11 Receptor |
| Gene Abbr. | IL11RA |
| Gene ID | 3590 |
| Full Name | interleukin 11 receptor subunit alpha |
| Alias | CRSDA |
| Species | Human |
| Genomic Locus | chr9:34655631 |
| Transcript | NM_001142784 |
| WT Expression Level | 5.72 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the gp130 transducing subunit in their high affinity receptors. This gene encodes the IL-11 receptor, which is a member of the hematopoietic cytokine receptor family. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of IL11RA. |
| Description | 23bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCCGTGAAGCTGTGTTGTCC |
| PCR Primer |
Forward: TCTCTGACCTCTGTCTCCAGATTAT Reverse: GACAGATAGAGAGGTGAGGATTACG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.