Il10rb cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Il10rb cDNA ORF Clone, Rat, untagged

Il10rb cDNA ORF Clone, Rat, untagged

SPD-06935

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 10 receptor, beta.
Target Information
Species Rat
Target Name IL-10 Receptor
Gene Abbr. Il10rb
Gene ID 304091
Full Name interleukin 10 receptor subunit beta
Alias RGD1560373
Introduction The protein encoded by this gene belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. This gene and three other interferon receptor genes, IFAR2, IFNAR1, and IFNGR2, form a class II cytokine receptor gene cluster located in a small region on chromosome 21.
Product Details
Description Full length Clone DNA of Rat interleukin 10 receptor, beta.
NCBI Ref Seq NM_001107111.1
RefSeq ORF Size 1056 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.