Online Inquiry
Il10rb cDNA ORF Clone, Mouse, N-HA tag
SPD-06944
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse interleukin 10 receptor, beta with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | IL-10 Receptor |
| Gene Abbr. | Il10rb |
| Gene ID | 16155 |
| Full Name | interleukin 10 receptor, beta |
| Alias | 6620401D04Rik, AI528744, CRF2-, CRF2-4, Crfb |
| Introduction | The protein encoded by this gene belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. This gene and three other interferon receptor genes, IFAR2, IFNAR1, and IFNGR2, form a class II cytokine receptor gene cluster located in a small region on chromosome 21. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse interleukin 10 receptor, beta with N terminal HA tag. |
| NCBI Ref Seq | NM_008349.4 |
| RefSeq ORF Size | 1057 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-SP-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | HindIII + XbaI (6kb + 1.14kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.