IL10RB cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

IL10RB cDNA ORF Clone, Human, untagged

IL10RB cDNA ORF Clone, Human, untagged

SPD-06955

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 10 receptor, beta.
Target Information
Species Human
Target Name IL-10 Receptor
Gene Abbr. IL10RB
Gene ID 3588
Full Name interleukin 10 receptor subunit beta
Alias CDW210B, CRF2-4, CRFB4, D21S58, D21S66
Introduction The protein encoded by this gene belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. This gene and three other interferon receptor genes, IFAR2, IFNAR1, and IFNGR2, form a class II cytokine receptor gene cluster located in a small region on chromosome 21.
Product Details
Description Full length Clone DNA of Human interleukin 10 receptor, beta.
NCBI Ref Seq NM_000628.3
RefSeq ORF Size 978 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + NotI (6.1kb + 0.98kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.