Online Inquiry
Il10ra cDNA ORF Clone, Rat, untagged
SPD-06905
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rat interleukin 10 receptor, alpha. |
| Target Information | |
|---|---|
| Species | Rat |
| Target Name | IL-10 Receptor |
| Gene Abbr. | Il10ra |
| Gene ID | 117539 |
| Full Name | interleukin 10 receptor subunit alpha |
| Introduction | IL-10, initially designated cytokine synthesis inhibitory factor (CSIF), is a potent immunosuppressant of macrophage functions. IL-10 is also a pleiotropic cytokine with multiple immunostimulatory as well as immunosuppressive effects on a variety of other cell types. IL-10 binds specifically and with high affinity to cell-surface receptors. Mouse and human cDNA clones encoding the ligand-binding IL-10 receptor (IL-10 R) have been isolated. The IL-10 R mRNA has been detected in all cell types that are known to respond to IL-10. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rat interleukin 10 receptor, alpha. |
| NCBI Ref Seq | NM_057193.2 |
| RefSeq ORF Size | 1710 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.