Il10ra cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Il10ra cDNA ORF Clone, Mouse, untagged

Il10ra cDNA ORF Clone, Mouse, untagged

SPD-06895

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 10 receptor,alpha.
Target Information
Species Mouse
Target Name IL-10 Receptor
Gene Abbr. Il10ra
Gene ID 16154
Full Name interleukin 10 receptor, alpha
Alias AW553859, CDw210, CDw210a, IL-10R1, IL-10RA
Introduction IL-10, initially designated cytokine synthesis inhibitory factor (CSIF), is a potent immunosuppressant of macrophage functions. IL-10 is also a pleiotropic cytokine with multiple immunostimulatory as well as immunosuppressive effects on a variety of other cell types. IL-10 binds specifically and with high affinity to cell-surface receptors. Mouse and human cDNA clones encoding the ligand-binding IL-10 receptor (IL-10 R) have been isolated. The IL-10 R mRNA has been detected in all cell types that are known to respond to IL-10.
Product Details
Description Full length Clone DNA of Mouse interleukin 10 receptor,alpha.
NCBI Ref Seq NM_008348.2
RefSeq ORF Size 1728 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.73kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.