IL10RA cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

IL10RA cDNA ORF Clone, Human, N-His tag

IL10RA cDNA ORF Clone, Human, N-His tag

SPD-06912

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 10 receptor, alpha (IL10RA) with N terminal His tag.
Target Information
Species Human
Target Name IL-10 Receptor
Gene Abbr. IL10RA
Gene ID 3587
Full Name interleukin 10 receptor subunit alpha
Alias CD210, CD210a, CDW210A, HIL-10R, IL-10R1
Introduction IL-10, initially designated cytokine synthesis inhibitory factor (CSIF), is a potent immunosuppressant of macrophage functions. IL-10 is also a pleiotropic cytokine with multiple immunostimulatory as well as immunosuppressive effects on a variety of other cell types. IL-10 binds specifically and with high affinity to cell-surface receptors. Mouse and human cDNA clones encoding the ligand-binding IL-10 receptor (IL-10 R) have been isolated. The IL-10 R mRNA has been detected in all cell types that are known to respond to IL-10.
Product Details
Description Full length Clone DNA of Human interleukin 10 receptor, alpha (IL10RA) with N terminal His tag.
NCBI Ref Seq NM_001558.2
RefSeq ORF Size 1737 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.