Online Inquiry
Il10 cDNA ORF Clone, Rat, C-Myc tag
SPD-06848
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat interleukin 10 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | IL-10 |
Gene Abbr. | Il10 |
Gene ID | 25325 |
Full Name | interleukin 10 |
Alias | IL10X |
Introduction | The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat interleukin 10 with C terminal Myc tag. |
NCBI Ref Seq | NM_012854.2 |
RefSeq ORF Size | 537 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.