Il10 cDNA ORF Clone, Rat, C-HA tag - CD BioSciences

service-banner

Il10 cDNA ORF Clone, Rat, C-HA tag

Il10 cDNA ORF Clone, Rat, C-HA tag

SPD-06849

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 10 with C terminal HA tag.
Target Information
Species Rat
Target Name IL-10
Gene Abbr. Il10
Gene ID 25325
Full Name interleukin 10
Alias IL10X
Introduction The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Rat interleukin 10 with C terminal HA tag.
NCBI Ref Seq NM_012854.2
RefSeq ORF Size 537 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.