Il10 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Il10 cDNA ORF Clone, Mouse, untagged

Il10 cDNA ORF Clone, Mouse, untagged

SPD-06865

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 10.
Target Information
Species Mouse
Target Name IL-10
Gene Abbr. Il10
Gene ID 16153
Full Name interleukin 10
Alias CSIF, IL-, Il-10
Introduction The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Mouse interleukin 10.
NCBI Ref Seq NM_010548.1
RefSeq ORF Size 537 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 0.54kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.