IKBKG Knockout Cell Line - CD BioSciences

service-banner

IKBKG Knockout Cell Line

IKBKG Knockout Cell Line

SPL-01702

Size Price
1 Unit Online Inquiry
Description
598bp insertion
Target Information
Target Name IKKγ
Gene Abbr. IKBKG
Gene ID 8517
Full Name inhibitor of nuclear factor kappa B kinase regulatory subunit gamma
Alias AMCBX1, EDAID1, FIP-3, FIP3, Fip3p
Species Human
Genomic Locus chrX:154552116
Transcript NM_001099857
WT Expression Level 25.39 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes the regulatory subunit of the inhibitor of kappaB kinase (IKK) complex, which activates NF-kappaB resulting in activation of genes involved in inflammation, immunity, cell survival, and other pathways. Mutations in this gene result in incontinentia pigmenti, hypohidrotic ectodermal dysplasia, and several other types of immunodeficiencies. A pseudogene highly similar to this locus is located in an adjacent region of the X chromosome. [provided by RefSeq, Mar 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 598bp insertion in a coding exon of IKBKG.
Description 598bp insertion
Parental Cell Line C631
Guide RNA Sequence GCTGCACCTGCCTTCAGAAC
PCR Primer Forward: CCCACTTTAGCATCCTGATACACTA
Reverse: AGAAGACGCCTTCCCCTCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.