Online Inquiry
IKBKG Knockout Cell Line
SPL-01701
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 269bp insertion |
| Target Information | |
|---|---|
| Target Name | IKKγ |
| Gene Abbr. | IKBKG |
| Gene ID | 8517 |
| Full Name | inhibitor of nuclear factor kappa B kinase regulatory subunit gamma |
| Alias | AMCBX1, EDAID1, FIP-3, FIP3, Fip3p |
| Species | Human |
| Genomic Locus | chrX:154552116 |
| Transcript | NM_001099857 |
| WT Expression Level | 25.39 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes the regulatory subunit of the inhibitor of kappaB kinase (IKK) complex, which activates NF-kappaB resulting in activation of genes involved in inflammation, immunity, cell survival, and other pathways. Mutations in this gene result in incontinentia pigmenti, hypohidrotic ectodermal dysplasia, and several other types of immunodeficiencies. A pseudogene highly similar to this locus is located in an adjacent region of the X chromosome. [provided by RefSeq, Mar 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 269bp insertion in a coding exon of IKBKG. |
| Description | 269bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTGCACCTGCCTTCAGAAC |
| PCR Primer |
Forward: CCCACTTTAGCATCCTGATACACTA Reverse: AGAAGACGCCTTCCCCTCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.