Online Inquiry
IKBKE Knockout Cell Line
SPL-01699
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | IKKε |
| Gene Abbr. | IKBKE |
| Gene ID | 9641 |
| Full Name | inhibitor of nuclear factor kappa B kinase subunit epsilon |
| Alias | IKK-E, IKK-i, IKKE, IKKI |
| Species | Human |
| Genomic Locus | chr1:206476237 |
| Transcript | NM_014002 |
| WT Expression Level | 3.84 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | IKBKE is a noncanonical I-kappa-B (see MIM 164008) kinase (IKK) that is essential for regulating antiviral signaling pathways. IKBKE has also been identified as a breast cancer (MIM 114480) oncogene and is amplified and overexpressed in over 30% of breast carcinomas and breast cancer cell lines (Hutti et al., 2009 [PubMed 19481526]).[supplied by OMIM, Oct 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of IKBKE. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACGAGGCGCATGATGTTCCC |
| PCR Primer |
Forward: GAGAATCCAGATGGTACCTCCATAC Reverse: AGGTACTCCTCAGTCCCATAGAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.