Online Inquiry
IKBKE cDNA ORF Clone, Human, N-FLAG tag
SPD-06674
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human inhibitor of nuclear factor kappa B kinase subunit epsilon |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | IKKε |
| Gene Abbr. | IKBKE |
| Gene ID | 9641 |
| Full Name | inhibitor of nuclear factor kappa B kinase subunit epsilon |
| Alias | IKK-E, IKK-i, IKKE, IKKI |
| Introduction | The NF-κB/Rel transcription factors are present in the cytosol in an inactive state, complexed with the inhibitory IκB proteins. Most agents that activate NF-κB do so through a common pathway based on phosphorylation-induced, proteasome-mediated degradation of IκB. The key regulatory step in this pathway involves activation of a high molecular weight IκB kinase (IKK) complex whose catalysis is generally carried out by three tightly associated IKK subunits. IKKα and IKKβ serve as the catalytic subunits of the kinase and IKKγ serves as the regulatory subunit. Activation of IKK depends upon phosphorylation at Ser177 and Ser181 in the activation loop of IKKβ (Ser176 and Ser180 in IKKα), which causes conformational changes, resulting in kinase activation.Recently, two homologs of IKKα and IKKβ have been described, called IKKε (also known as IKK-i) and TBK1 (also known as T2K or NAK). Activation of either of these kinases results in NF-κB activation. IKKε contains the kinase domain in its amino terminus, which shares 30% identity to that of IKKα or IKKβ. IKKε is expressed mainly in immune cells and may play a special role in the immune response. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human inhibitor of nuclear factor kappa B kinase subunit epsilon |
| NCBI Ref Seq | BC107812 |
| RefSeq ORF Size | 1935 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 1.94kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.