IKBKB cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

IKBKB cDNA ORF Clone, Human, C-Myc tag

IKBKB cDNA ORF Clone, Human, C-Myc tag

SPD-06662

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta with C terminal Myc tag.
Target Information
Species Human
Target Name IKKβ
Gene Abbr. IKBKB
Gene ID 3551
Full Name inhibitor of nuclear factor kappa B kinase subunit beta
Alias IKK-beta, IKK2, IKKB, IMD15, IMD15A
Introduction The NF-κB/Rel transcription factors are present in the cytosol in an inactive state, complexed with the inhibitory IκB proteins. Most agents that activate NF-κB do so through a common pathway based on phosphorylation-induced, proteasome-mediated degradation of IκB. The key regulatory step in this pathway involves activation of a high molecular weight IκB kinase (IKK) complex whose catalysis is generally carried out by three tightly associated IKK subunits. IKKα and IKKβ serve as the catalytic subunits of the kinase and IKKγ serves as the regulatory subunit. Activation of IKK depends upon phosphorylation at Ser177 and Ser181 in the activation loop of IKKβ (Ser176 and Ser180 in IKKα), which causes conformational changes, resulting in kinase activation.
Product Details
Description Full length Clone DNA of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta with C terminal Myc tag.
NCBI Ref Seq NM_001556.1
RefSeq ORF Size 2271 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 2.32kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.