IGF1R cDNA ORF Clone, Rhesus, C-Myc tag - CD BioSciences

service-banner

IGF1R cDNA ORF Clone, Rhesus, C-Myc tag

IGF1R cDNA ORF Clone, Rhesus, C-Myc tag

SPD-06620

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus insulin-like growth factor 1 receptor with C terminal Myc tag.
Target Information
Species Rhesus
Target Name IGF Receptor
Gene Abbr. IGF1R
Gene ID 708227
Full Name insulin like growth factor 1 receptor
Introduction Type I insulin-like growth factor receptor (IGF-IR) is a transmembrane receptor tyrosine kinase that is widely expressed in many cell types in fetal and postnatal tissues, and which is highly similar in sequence and structure to the insulin receptor. IGF-IR is synthesized as a preproprotein which is proteolytically cleaved into alpha and beta subunits. Receptor assembly involves heterodimerization of two alpha and two beta subunits to generate the heterotetrameric transmembrane receptor. The alpha subunits form the extracellular ligand binding domain; ligand binding by IGF-I or IGF-II initiates autophosphorylation of conserved intracellular residues in the beta subunit kinase domain, leading to kinase activation and subsequent activation of downstream signal transduction pathways (e.g., Akt and MAPK). Enhanced mitogenic signaling through the IGF1R is frequently observed in cancer, making the IGF-IR an important research target in translational oncology.
Product Details
Description Full length Clone DNA of Rhesus insulin-like growth factor 1 receptor with C terminal Myc tag.
NCBI Ref Seq XM_001100407.2
RefSeq ORF Size 4104 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.