Online Inquiry
IGF1R cDNA ORF Clone, Human, N-HA tag
SPD-06647
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human insulin-like growth factor 1 receptor with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IGF Receptor |
Gene Abbr. | IGF1R |
Gene ID | 3480 |
Full Name | insulin like growth factor 1 receptor |
Alias | CD221, IGFIR, IGFR, JTK13 |
Introduction | Type I insulin-like growth factor receptor (IGF-IR) is a transmembrane receptor tyrosine kinase that is widely expressed in many cell types in fetal and postnatal tissues, and which is highly similar in sequence and structure to the insulin receptor. IGF-IR is synthesized as a preproprotein which is proteolytically cleaved into alpha and beta subunits. Receptor assembly involves heterodimerization of two alpha and two beta subunits to generate the heterotetrameric transmembrane receptor. The alpha subunits form the extracellular ligand binding domain; ligand binding by IGF-I or IGF-II initiates autophosphorylation of conserved intracellular residues in the beta subunit kinase domain, leading to kinase activation and subsequent activation of downstream signal transduction pathways (e.g., Akt and MAPK). Enhanced mitogenic signaling through the IGF1R is frequently observed in cancer, making the IGF-IR an important research target in translational oncology. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human insulin-like growth factor 1 receptor with N terminal HA tag. |
NCBI Ref Seq | NM_000875.3 |
RefSeq ORF Size | 4104 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | KpnI (two restriction sites) + XbaI (1.54kb + 2.57kb + 6.0kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.