Ifnl2 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Ifnl2 cDNA ORF Clone, Mouse, untagged

Ifnl2 cDNA ORF Clone, Mouse, untagged

SPD-09326

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interferon lambda 2.
Target Information
Species Mouse
Target Name Interferon
Gene Abbr. Ifnl2
Gene ID 330496
Full Name interferon lambda 2
Alias EG330496, IL-28A, Il, Il28a
Product Details
Description Full length Clone DNA of Mouse interferon lambda 2.
NCBI Ref Seq NM_001024673.2
RefSeq ORF Size 582 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.