Online Inquiry
IFNGR2 Knockout Cell Line
SPL-01693
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 188bp insertion |
| Target Information | |
|---|---|
| Target Name | Interferon Receptor |
| Gene Abbr. | IFNGR2 |
| Gene ID | 3460 |
| Full Name | interferon gamma receptor 2 |
| Alias | AF-1, IFGR2, IFNGT1, IMD28 |
| Species | Human |
| Genomic Locus | chr21:33414922 |
| Transcript | NM_005534 |
| WT Expression Level | 40.35 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene (IFNGR2) encodes the non-ligand-binding beta chain of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. Defects in IFNGR2 are a cause of mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. MSMD is a genetically heterogeneous disease with autosomal recessive, autosomal dominant or X-linked inheritance. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 188bp insertion in a coding exon of IFNGR2. |
| Description | 188bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGTTGTACAGGCGAATCTTC |
| PCR Primer |
Forward: CTCTTTTCTTTTTGTGCTGCCTGTA Reverse: CCAGCAAGGATCCAACAGAAATACC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.