Online Inquiry
IFNGR1 Knockout Cell Line
SPL-01691
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | Interferon Receptor |
| Gene Abbr. | IFNGR1 |
| Gene ID | 3459 |
| Full Name | interferon gamma receptor 1 |
| Alias | CD119, IFNGR, IMD27A, IMD27B |
| Species | Human |
| Genomic Locus | chr6:137207022 |
| Transcript | NM_000416 |
| WT Expression Level | 15.60 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of IFNGR1. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACATGAACCCTATCGTATAT |
| PCR Primer |
Forward: CTGATGAAAGAACACAGTTGTGGAA Reverse: CAATGTGGCATCTTACAATAAGGCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.