IFNG cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

IFNG cDNA ORF Clone, Rhesus, untagged

IFNG cDNA ORF Clone, Rhesus, untagged

SPD-09276

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus interferon-gamma.
Target Information
Species Rhesus
Target Name Interferon
Gene Abbr. IFNG
Gene ID 574282
Full Name interferon gamma
Introduction Interferon-gamma (IFN-gamma) is a dimerized soluble cytokine that is the only member of the type II class of interferons. This interferon was originally called macrophage-activating factor, a term now used to describe a larger family of proteins to which IFN-gamma belongs. IFN-gamma, or type II interferon, is a cytokine that is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN-gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN-gamma in the immune system stems in part from its ability to inhibit viral replication directly, but, most important, derives from its immunostimulatory and immunomodulatory effects. IFN-gamma is produced predominantly by natural killer (NK) and natural killer T (NKT) cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte (CTL) effector T cells once antigen-specific immunity develops.
Product Details
Description Full length Clone DNA of Rhesus interferon-gamma.
NCBI Ref Seq NM_001032905.1
RefSeq ORF Size 498 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.