Online Inquiry
IFNG cDNA ORF Clone, Rhesus, C-Myc tag
SPD-09269
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rhesus interferon-gamma with C terminal Myc tag. |
Target Information | |
---|---|
Species | Rhesus |
Target Name | Interferon |
Gene Abbr. | IFNG |
Gene ID | 574282 |
Full Name | interferon gamma |
Introduction | Interferon-gamma (IFN-gamma) is a dimerized soluble cytokine that is the only member of the type II class of interferons. This interferon was originally called macrophage-activating factor, a term now used to describe a larger family of proteins to which IFN-gamma belongs. IFN-gamma, or type II interferon, is a cytokine that is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN-gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN-gamma in the immune system stems in part from its ability to inhibit viral replication directly, but, most important, derives from its immunostimulatory and immunomodulatory effects. IFN-gamma is produced predominantly by natural killer (NK) and natural killer T (NKT) cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte (CTL) effector T cells once antigen-specific immunity develops. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rhesus interferon-gamma with C terminal Myc tag. |
NCBI Ref Seq | NM_001032905.1 |
RefSeq ORF Size | 498 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.