Ifng cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Ifng cDNA ORF Clone, Mouse, N-His tag

Ifng cDNA ORF Clone, Mouse, N-His tag

SPD-09293

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interferon gamma with N terminal His tag.
Target Information
Species Mouse
Target Name Interferon
Gene Abbr. Ifng
Gene ID 15978
Full Name interferon gamma
Alias IFN-g, If, Ifg
Introduction Interferon-gamma (IFN-gamma) is a dimerized soluble cytokine that is the only member of the type II class of interferons. This interferon was originally called macrophage-activating factor, a term now used to describe a larger family of proteins to which IFN-gamma belongs. IFN-gamma, or type II interferon, is a cytokine that is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN-gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN-gamma in the immune system stems in part from its ability to inhibit viral replication directly, but, most important, derives from its immunostimulatory and immunomodulatory effects. IFN-gamma is produced predominantly by natural killer (NK) and natural killer T (NKT) cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte (CTL) effector T cells once antigen-specific immunity develops.
Product Details
Description Full length Clone DNA of Mouse interferon gamma with N terminal His tag.
NCBI Ref Seq NM_008337.3
RefSeq ORF Size 468 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 0.5kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.