Online Inquiry
IFNAR2 Knockout Cell Line
SPL-01690
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
8bp deletion |
Target Information | |
---|---|
Target Name | Interferon Receptor |
Gene Abbr. | IFNAR2 |
Gene ID | 3455 |
Full Name | interferon alpha and beta receptor subunit 2 |
Alias | IFN-R, IFN-alpha-REC, IFNABR, IFNARB, IMD45 |
Species | Human |
Genomic Locus | chr21:33244993 |
Transcript | NM_207585 |
WT Expression Level | 16.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of IFNAR2. |
Description | 8bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATTTCCGGTCCATCTTATCA |
PCR Primer |
Forward: TGTCCTGTAGACTTCCTGTTTTCAA Reverse: ACCTCTCCCCATATAACAGAACAAT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.