Online Inquiry
HUWE1 Knockout Cell Line
SPL-01679
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 28bp deletion |
| Target Information | |
|---|---|
| Target Name | HECTH9 |
| Gene Abbr. | HUWE1 |
| Gene ID | 10075 |
| Full Name | HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 |
| Alias | ARF-BP1, HECTH9, HSPC272, Ib772, LASU1 |
| Species | Human |
| Genomic Locus | chrX:53631010 |
| Transcript | NM_031407 |
| WT Expression Level | 57.51 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein containing a C-terminal HECT (E6AP type E3 ubiquitin protein ligase) domain that functions as an E3 ubiquitin ligase. The encoded protein is required for the ubiquitination and subsequent degradation of the anti-apoptotic protein Mcl1 (myeloid cell leukemia sequence 1 (BCL2-related)). This protein also ubiquitinates the p53 tumor suppressor, core histones, and DNA polymerase beta. Mutations in this gene are associated with Turner type X-linked syndromic mental retardation. [provided by RefSeq, Aug 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 28bp deletion in a coding exon of HUWE1. |
| Description | 28bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTTATTTACACACATACGAC |
| PCR Primer |
Forward: AGGGGTGGAAGTATTTAAGTTGCTA Reverse: TGAACACTTCGGATATCAAAGGAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.