HTR6 Knockout Cell Line - CD BioSciences

service-banner

HTR6 Knockout Cell Line

HTR6 Knockout Cell Line

SPL-01676

Size Price
1 Unit Online Inquiry
Description
13bp deletion
Target Information
Target Name HTR6
Gene Abbr. HTR6
Gene ID 3362
Full Name 5-hydroxytryptamine receptor 6
Alias 5-HT6, 5-HT6R
Species Human
Genomic Locus chr1:19666008
Transcript NM_000871
WT Expression Level 0.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a protein that belongs to the seven-transmembrane G protein-coupled receptor family of proteins. The encoded protein couples with the Gs alpha subunit and stimulates adenylate cyclase to activate the cyclic AMP-dependent signaling pathway. This receptor is thought to regulate cholinergic neuronal transmission in the brain. Several antidepressants and antipsychotic drugs have a high affinity for this receptor. [provided by RefSeq, Aug 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of HTR6.
Description 13bp deletion
Parental Cell Line C631
Guide RNA Sequence GAACGCGCTGTACGGGCGCT
PCR Primer Forward: GGCCAACTCGCTGCTGAT
Reverse: GATCCTGCAGTAGGTGAAGCATA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.