Online Inquiry
HTR6 Knockout Cell Line
SPL-01676
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | HTR6 |
| Gene Abbr. | HTR6 |
| Gene ID | 3362 |
| Full Name | 5-hydroxytryptamine receptor 6 |
| Alias | 5-HT6, 5-HT6R |
| Species | Human |
| Genomic Locus | chr1:19666008 |
| Transcript | NM_000871 |
| WT Expression Level | 0.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein that belongs to the seven-transmembrane G protein-coupled receptor family of proteins. The encoded protein couples with the Gs alpha subunit and stimulates adenylate cyclase to activate the cyclic AMP-dependent signaling pathway. This receptor is thought to regulate cholinergic neuronal transmission in the brain. Several antidepressants and antipsychotic drugs have a high affinity for this receptor. [provided by RefSeq, Aug 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of HTR6. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAACGCGCTGTACGGGCGCT |
| PCR Primer |
Forward: GGCCAACTCGCTGCTGAT Reverse: GATCCTGCAGTAGGTGAAGCATA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.