HSPG2 Knockout Cell Line - CD BioSciences

service-banner

HSPG2 Knockout Cell Line

HSPG2 Knockout Cell Line

SPL-01668

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name HSPG2
Gene Abbr. HSPG2
Gene ID 3339
Full Name heparan sulfate proteoglycan 2
Alias HSPG, PLC, PRCAN, SJA, SJS
Species Human
Genomic Locus chr1:21890602
Transcript NM_005529
WT Expression Level 4.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of HSPG2.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence AGAGTTCCGAGAGGTGTCCG
PCR Primer Forward: GAATTTTCAAGTACTCCGACTCCAG
Reverse: GGGCTCTCAAAATGATCCTCCTTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.