HSPB1 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

HSPB1 cDNA ORF Clone, Human, N-Myc tag

HSPB1 cDNA ORF Clone, Human, N-Myc tag

SPD-06524

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human heat shock 27kDa protein 1 with N terminal Myc tag.
Target Information
Species Human
Target Name HSP27
Gene Abbr. HSPB1
Gene ID 3315
Full Name heat shock protein family B (small) member 1
Alias CMT2F, HEL-S-102, HMN2B, HS.76067, HSP27
Introduction Heat shock protein (HSP) 27 is one of the small HSPs that are constitutively expressed at different levels in various cell types and tissues. Like other small HSPs, HSP27 is regulated at both the transcriptional and posttranslational levels. In response to stress, the HSP27 expression increases several-fold to confer cellular resistance to the adverse environmental change. HSP27 is phosphorylated at Ser15, Ser78, and Ser82 by MAPKAPK-2 as a result of the activation of the p38 MAP kinase pathway. Phosphorylation of HSP27 causes a change in its tertiary structure, which shifts from large homotypic multimers to dimers and monomers. It has been shown that phosphorylation and increased concentration of HSP27 modulates actin polymerization and reorganization.
Product Details
Description Full length Clone DNA of Human heat shock 27kDa protein 1 with N terminal Myc tag.
NCBI Ref Seq NM_001540.3
RefSeq ORF Size 618 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.