Online Inquiry
HSPB1 cDNA ORF Clone, Human, C-FLAG tag
SPD-06517
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human heat shock 27kDa protein 1 with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | HSP27 |
| Gene Abbr. | HSPB1 |
| Gene ID | 3315 |
| Full Name | heat shock protein family B (small) member 1 |
| Alias | CMT2F, HEL-S-102, HMN2B, HS.76067, HSP27 |
| Introduction | Heat shock protein (HSP) 27 is one of the small HSPs that are constitutively expressed at different levels in various cell types and tissues. Like other small HSPs, HSP27 is regulated at both the transcriptional and posttranslational levels. In response to stress, the HSP27 expression increases several-fold to confer cellular resistance to the adverse environmental change. HSP27 is phosphorylated at Ser15, Ser78, and Ser82 by MAPKAPK-2 as a result of the activation of the p38 MAP kinase pathway. Phosphorylation of HSP27 causes a change in its tertiary structure, which shifts from large homotypic multimers to dimers and monomers. It has been shown that phosphorylation and increased concentration of HSP27 modulates actin polymerization and reorganization. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human heat shock 27kDa protein 1 with C terminal Flag tag. |
| NCBI Ref Seq | NM_001540.3 |
| RefSeq ORF Size | 618 bp |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.