Online Inquiry
HSP90B1 cDNA ORF Clone, Human, N-FLAG tag
SPD-06229
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human heat shock protein 90kDa beta (Grp94), member 1 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Grp94 |
Gene Abbr. | HSP90B1 |
Gene ID | 7184 |
Full Name | heat shock protein 90 beta family member 1 |
Alias | ECGP, GP96, GRP94, HEL-S-125m, HEL35 |
Introduction | Secretory proteins are synthesized on polysomes and translocated into the endoplasmic reticulum (ER). Inside ER, these proteins are often modified by disulfide bond formation, amino-linked glycosylation and folding. The ER contains a pool of molecular chaperones, including Grp94, to help ensure correct protein folding. Grp94 is a glucose-regulated protein with sequence homology to Hsp90. In addition to its role in helping to facilitate folding of a number of secretory proteins to their correct conformation, studies suggest that Grp94 derived from cancer cells also induces anti-tumor immune responses in mouse tumor models. One way in which Grp94 promotes tumor immunogenicity is its ability to bind to and present tumor-derived peptides as antigens. Furthermore, Grp94 has also been shown to induce maturation of dendritic cells. Taken together, Grp94 functions both as a tumor-specific antigen and as an activator of antigen-presenting cells to elicit an anti-cancer immune response. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human heat shock protein 90kDa beta (Grp94), member 1 with N terminal Flag tag. |
NCBI Ref Seq | NM_003299.2 |
RefSeq ORF Size | 2436 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI (three restriction sites) + XbaI (6kb + 0.52kb + 0.98kb + 0.95kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.