Hsp90ab1 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Hsp90ab1 cDNA ORF Clone, Rat, untagged

Hsp90ab1 cDNA ORF Clone, Rat, untagged

SPD-06546

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat heat shock protein 90 alpha (cytosolic), class B member 1.
Target Information
Species Rat
Target Name HSP90
Gene Abbr. Hsp90ab1
Gene ID 301252
Full Name heat shock protein 90 alpha family class B member 1
Alias HSP90-BETA, HSP90B, HSPC2, Hspcb
Introduction HSP70 and HSP90 are molecular chaperones expressed constitutively under normal conditions to maintain protein homeostasis and are induced upon environmental stress. Both HSP70 and HSP90 are able to interact with unfolded proteins to prevent irreversible aggregation and catalyze the refolding of their substrates in an ATP- and co-chaperone-dependent manner. HSP70 has a broad range of substrates including newly synthesized and denatured proteins, while HSP90 tends to have a more limited subset of substrates, most of which are signaling molecules. HSP70 and HSP90 often function collaboratively in a multi-chaperone system, which requires a minimal set of co-chaperones: HSP40, Hop, and p23. The co-chaperones either regulate the intrinsic ATPase activity of the chaperones or recruit chaperones to specific substrates or subcellular compartments. When the ubiquitin ligase CHIP associates with the HSP70/HSP90 complex as a cofactor, the unfolded substrates are subjected to degradation by the proteasome. The biological functions of HSP70/HSP90 extend beyond their chaperone activity. They are essential for the maturation and inactivation of nuclear hormones and other signaling molecules. They also play a role in vesicle formation and protein trafficking.
Product Details
Description Full length Clone DNA of Rat heat shock protein 90 alpha (cytosolic), class B member 1.
NCBI Ref Seq AY695393.1
RefSeq ORF Size 2175 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.