Online Inquiry
Hsp90ab1 cDNA ORF Clone, Rat, N-Myc tag
SPD-06543
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat heat shock protein 90 alpha (cytosolic), class B member 1 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | HSP90 |
Gene Abbr. | Hsp90ab1 |
Gene ID | 301252 |
Full Name | heat shock protein 90 alpha family class B member 1 |
Alias | HSP90-BETA, HSP90B, HSPC2, Hspcb |
Introduction | HSP70 and HSP90 are molecular chaperones expressed constitutively under normal conditions to maintain protein homeostasis and are induced upon environmental stress. Both HSP70 and HSP90 are able to interact with unfolded proteins to prevent irreversible aggregation and catalyze the refolding of their substrates in an ATP- and co-chaperone-dependent manner. HSP70 has a broad range of substrates including newly synthesized and denatured proteins, while HSP90 tends to have a more limited subset of substrates, most of which are signaling molecules. HSP70 and HSP90 often function collaboratively in a multi-chaperone system, which requires a minimal set of co-chaperones: HSP40, Hop, and p23. The co-chaperones either regulate the intrinsic ATPase activity of the chaperones or recruit chaperones to specific substrates or subcellular compartments. When the ubiquitin ligase CHIP associates with the HSP70/HSP90 complex as a cofactor, the unfolded substrates are subjected to degradation by the proteasome. The biological functions of HSP70/HSP90 extend beyond their chaperone activity. They are essential for the maturation and inactivation of nuclear hormones and other signaling molecules. They also play a role in vesicle formation and protein trafficking. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat heat shock protein 90 alpha (cytosolic), class B member 1 with N terminal Myc tag. |
NCBI Ref Seq | AY695393.1 |
RefSeq ORF Size | 2175 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.