Online Inquiry
HPRT1 Knockout Cell Line
SPL-01658
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | HPRT1 |
| Gene Abbr. | HPRT1 |
| Gene ID | 3251 |
| Full Name | hypoxanthine phosphoribosyltransferase 1 |
| Alias | HGPRT, HPRT |
| Species | Human |
| Genomic Locus | chrX:134473446 |
| Transcript | NM_000194 |
| WT Expression Level | 121.68 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout.[provided by RefSeq, Jun 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of HPRT1. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGTCCATAATTAGTCCATG |
| PCR Primer |
Forward: TCCTGTAATGCTCTCATTGAAACAG Reverse: TTACTTTGTTCTGGTCCCTACAGAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.