HNF4A cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

HNF4A cDNA ORF Clone, Human, N-FLAG tag

HNF4A cDNA ORF Clone, Human, N-FLAG tag

SPD-06490

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human hepatocyte nuclear factor 4, alpha, transcript variant 3 with N terminal Flag tag.
Target Information
Species Human
Target Name HNF4α
Gene Abbr. HNF4A
Gene ID 3172
Full Name hepatocyte nuclear factor 4 alpha
Alias FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9
Introduction Hepatocyte nuclear factor 4α (HNF4α) is a transcription factor that belongs to the steroid hormone receptor superfamily and is enriched in liver. HNF4α, in association with PGC-1α, activates gluconeogenic genes such as phosphoenolpyruvate carboxykinase and glucose-6-phosphatase genes in fasted livers. Conditional knockout of the HNF4α gene in the mouse liver destroys lipid homeostasis and leads to lipid accumulation in the liver and a reduction of serum cholesterol and triglyceride levels. Mutations in HNF4α have been linked to maturity-onset diabetes of the young (MODY).
Product Details
Description Full length Clone DNA of Human hepatocyte nuclear factor 4, alpha, transcript variant 3 with N terminal Flag tag.
NCBI Ref Seq NM_178850
RefSeq ORF Size 1254 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.29kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.