Online Inquiry
HNF4A cDNA ORF Clone, Human, C-His tag
SPD-06486
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human hepatocyte nuclear factor 4, alpha, transcript variant 3 with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | HNF4α |
| Gene Abbr. | HNF4A |
| Gene ID | 3172 |
| Full Name | hepatocyte nuclear factor 4 alpha |
| Alias | FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9 |
| Introduction | Hepatocyte nuclear factor 4α (HNF4α) is a transcription factor that belongs to the steroid hormone receptor superfamily and is enriched in liver. HNF4α, in association with PGC-1α, activates gluconeogenic genes such as phosphoenolpyruvate carboxykinase and glucose-6-phosphatase genes in fasted livers. Conditional knockout of the HNF4α gene in the mouse liver destroys lipid homeostasis and leads to lipid accumulation in the liver and a reduction of serum cholesterol and triglyceride levels. Mutations in HNF4α have been linked to maturity-onset diabetes of the young (MODY). |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human hepatocyte nuclear factor 4, alpha, transcript variant 3 with C terminal His tag. |
| NCBI Ref Seq | NM_178850 |
| RefSeq ORF Size | 1254 bp |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.