Online Inquiry
HMMR Knockout Cell Line
SPL-01654
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 23bp deletion |
| Target Information | |
|---|---|
| Target Name | HMMR |
| Gene Abbr. | HMMR |
| Gene ID | 3161 |
| Full Name | hyaluronan mediated motility receptor |
| Alias | CD168, IHABP, RHAMM |
| Species | Human |
| Genomic Locus | chr5:163471412 |
| Transcript | NM_001142556 |
| WT Expression Level | 74.34 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of HMMR. |
| Description | 23bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGACTCTTCGAGACTCCTTT |
| PCR Primer |
Forward: AAGAGAAACAAAGATGAGGGTGAGT Reverse: ACTAACAGAAGGTTGAAGTCTCAGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.