Online Inquiry
Hmgb1 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-06455
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse high mobility group box 1 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | HMGB1 |
Gene Abbr. | Hmgb1 |
Gene ID | 15289 |
Full Name | high mobility group box 1 |
Alias | HMG-1, Hmg1, SBP, SBP-1, amph |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse high mobility group box 1 with C terminal Flag tag. |
NCBI Ref Seq | NM_010439.3 |
RefSeq ORF Size | 687 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 123C/T not causing the amino acid variation. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 0.69kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.