Online Inquiry
HIPK2 Knockout Cell Line
SPL-01645
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 29bp deletion |
| Target Information | |
|---|---|
| Target Name | HIPK2 |
| Gene Abbr. | HIPK2 |
| Gene ID | 28996 |
| Full Name | homeodomain interacting protein kinase 2 |
| Alias | PRO0593 |
| Species | Human |
| Genomic Locus | chr7:139631612 |
| Transcript | NM_022740 |
| WT Expression Level | 5.44 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 29bp deletion in a coding exon of HIPK2. |
| Description | 29bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCCGAAGCTCCTGGATATAA |
| PCR Primer |
Forward: TTCCAACTTGCTAATGGTTTCTTCC Reverse: GTTTGGGAGACAACGTGACATTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.