HIPK2 Knockout Cell Line - CD BioSciences

service-banner

HIPK2 Knockout Cell Line

HIPK2 Knockout Cell Line

SPL-01643

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name HIPK2
Gene Abbr. HIPK2
Gene ID 28996
Full Name homeodomain interacting protein kinase 2
Alias PRO0593
Species Human
Genomic Locus chr7:139631612
Transcript NM_022740
WT Expression Level 5.44 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of HIPK2.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence TCCGAAGCTCCTGGATATAA
PCR Primer Forward: TTCCAACTTGCTAATGGTTTCTTCC
Reverse: GTTTGGGAGACAACGTGACATTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.