HIPK2 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

HIPK2 cDNA ORF Clone, Human, untagged

HIPK2 cDNA ORF Clone, Human, untagged

SPD-06433

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human homeodomain interacting protein kinase 2 transcript variant 1.
Target Information
Species Human
Target Name HIPK2
Gene Abbr. HIPK2
Gene ID 28996
Full Name homeodomain interacting protein kinase 2
Alias PRO0593
Introduction Members of the homeodomain-interacting protein kinase (HIPK1-4) family of serine/threonine kinases regulate gene transcription with effects on cell proliferation, differentiation, and apoptosis. HIPK1-3 are nuclear proteins that were originally described as co-repressors for homeobox transcription factors. HIPK proteins can interact with and/or phosphorylate many transcriptional regulators.HIPK2 activated in response to DNA damage, including UV radiation and chemotherapeutic drugs, phosphorylates p53 at Ser46 to promote the transcription of pro-apoptotic p53 target genes. In addition, HIPK2 interacts with a number of transcription factors that control developmental processes, tumor suppression and apoptosis. The kinase is regulated by both sumoylation and ubiquitination. Ubiquitination and subsequent degradation of HIPK2 is inhibited by DNA damaging agents. Caspase-dependent cleavage of HIPK2 removes the inhibitory domain and results in enhanced HIPK2 activity.
Product Details
Description Full length Clone DNA of Human homeodomain interacting protein kinase 2 transcript variant 1.
NCBI Ref Seq NM_022740.4
RefSeq ORF Size 3597 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.