Online Inquiry
HIPK2 cDNA ORF Clone, Human, N-HA tag
SPD-06432
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human homeodomain interacting protein kinase 2 transcript variant 1 with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | HIPK2 |
Gene Abbr. | HIPK2 |
Gene ID | 28996 |
Full Name | homeodomain interacting protein kinase 2 |
Alias | PRO0593 |
Introduction | Members of the homeodomain-interacting protein kinase (HIPK1-4) family of serine/threonine kinases regulate gene transcription with effects on cell proliferation, differentiation, and apoptosis. HIPK1-3 are nuclear proteins that were originally described as co-repressors for homeobox transcription factors. HIPK proteins can interact with and/or phosphorylate many transcriptional regulators.HIPK2 activated in response to DNA damage, including UV radiation and chemotherapeutic drugs, phosphorylates p53 at Ser46 to promote the transcription of pro-apoptotic p53 target genes. In addition, HIPK2 interacts with a number of transcription factors that control developmental processes, tumor suppression and apoptosis. The kinase is regulated by both sumoylation and ubiquitination. Ubiquitination and subsequent degradation of HIPK2 is inhibited by DNA damaging agents. Caspase-dependent cleavage of HIPK2 removes the inhibitory domain and results in enhanced HIPK2 activity. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human homeodomain interacting protein kinase 2 transcript variant 1 with N terminal HA tag. |
NCBI Ref Seq | NM_022740.4 |
RefSeq ORF Size | 3597 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.