HIPK1 Knockout Cell Line - CD BioSciences

service-banner

HIPK1 Knockout Cell Line

HIPK1 Knockout Cell Line

SPL-01640

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name HIPK1
Gene Abbr. HIPK1
Gene ID 204851
Full Name homeodomain interacting protein kinase 1
Alias Myak, Nbak2
Species Human
Genomic Locus chr1:113940746
Transcript NM_198268
WT Expression Level 17.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene belongs to the Ser/Thr family of protein kinases and HIPK subfamily. It phosphorylates homeodomain transcription factors and may also function as a co-repressor for homeodomain transcription factors. Alternative splicing results in four transcript variants encoding four distinct isoforms. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of HIPK1.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence TGGATTGAAACGAAAAAGTG
PCR Primer Forward: CTACATCAACCTTCCAAAGCAGC
Reverse: TTGGTCATAGAGCAAAGGATCTCAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.