HIF1A cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

HIF1A cDNA ORF Clone, Human, C-His tag

HIF1A cDNA ORF Clone, Human, C-His tag

SPD-06415

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) with C terminal His tag.
Target Information
Species Human
Target Name HIF-1α
Gene Abbr. HIF1A
Gene ID 3091
Full Name hypoxia inducible factor 1 subunit alpha
Alias HIF-1-alpha, HIF-1A, HIF-1alpha, HIF1, HIF1-ALPHA
Introduction Hypoxia-inducible factor 1 (HIF1) is a heterodimeric transcription factor that plays a critical role in the cellular response to hypoxia. The HIF1 complex consists of two subunits, HIF-1α and HIF-1β, which are basic helix-loop-helix proteins of the PAS (Per, ARNT, Sim) family. HIF1 regulates the transcription of a broad range of genes that facilitate responses to the hypoxic environment, including genes regulating angiogenesis, erythropoiesis, cell cycle, metabolism, and apoptosis. The widely expressed HIF-1α is typically degraded rapidly in normoxic cells by the ubiquitin/proteasomal pathway. Under normoxic conditions, HIF-1α is proline hydroxylated leading to a conformational change that promotes binding to the von Hippel Lindau protein (VHL) E3 ligase complex; ubiquitination and proteasomal degradation follows. Both hypoxic conditions and chemical hydroxylase inhibitors (such as desferrioxamine and cobalt) inhibit HIF-1α degradation and lead to its stabilization. In addition, HIF-1α can be induced in an oxygen-independent manner by various cytokines through the PI3K-AKT-mTOR pathway.HIF-1β is also known as AhR nuclear translocator (ARNT) due to its ability to partner with the aryl hydrocarbon receptor (AhR) to form a heterodimeric transcription factor complex. Together with AhR, HIF-1β plays an important role in xenobiotics metabolism. In addition, a chromosomal translocation leading to a TEL-ARNT fusion protein is associated with acute myeloblastic leukemia. Studies also found that ARNT/HIF-1β expression levels decrease significantly in pancreatic islets from patients with type 2 diabetes, suggesting that HIF-1β plays an important role in pancreatic β-cell function.
Product Details
Description Full length Clone DNA of Human hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) with C terminal His tag.
NCBI Ref Seq NM_001530
RefSeq ORF Size 2526 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 2.53kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.