Online Inquiry
HIF1A cDNA ORF Clone, Human, C-HA tag
SPD-06417
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) with C terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | HIF-1α |
Gene Abbr. | HIF1A |
Gene ID | 3091 |
Full Name | hypoxia inducible factor 1 subunit alpha |
Alias | HIF-1-alpha, HIF-1A, HIF-1alpha, HIF1, HIF1-ALPHA |
Introduction | Hypoxia-inducible factor 1 (HIF1) is a heterodimeric transcription factor that plays a critical role in the cellular response to hypoxia. The HIF1 complex consists of two subunits, HIF-1α and HIF-1β, which are basic helix-loop-helix proteins of the PAS (Per, ARNT, Sim) family. HIF1 regulates the transcription of a broad range of genes that facilitate responses to the hypoxic environment, including genes regulating angiogenesis, erythropoiesis, cell cycle, metabolism, and apoptosis. The widely expressed HIF-1α is typically degraded rapidly in normoxic cells by the ubiquitin/proteasomal pathway. Under normoxic conditions, HIF-1α is proline hydroxylated leading to a conformational change that promotes binding to the von Hippel Lindau protein (VHL) E3 ligase complex; ubiquitination and proteasomal degradation follows. Both hypoxic conditions and chemical hydroxylase inhibitors (such as desferrioxamine and cobalt) inhibit HIF-1α degradation and lead to its stabilization. In addition, HIF-1α can be induced in an oxygen-independent manner by various cytokines through the PI3K-AKT-mTOR pathway.HIF-1β is also known as AhR nuclear translocator (ARNT) due to its ability to partner with the aryl hydrocarbon receptor (AhR) to form a heterodimeric transcription factor complex. Together with AhR, HIF-1β plays an important role in xenobiotics metabolism. In addition, a chromosomal translocation leading to a TEL-ARNT fusion protein is associated with acute myeloblastic leukemia. Studies also found that ARNT/HIF-1β expression levels decrease significantly in pancreatic islets from patients with type 2 diabetes, suggesting that HIF-1β plays an important role in pancreatic β-cell function. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) with C terminal HA tag. |
NCBI Ref Seq | NM_001530 |
RefSeq ORF Size | 2481 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | KpnI + XbaI (6kb + 2.52kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.