Online Inquiry
HDAC9 Knockout Cell Line
SPL-01629
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
23bp deletion |
Target Information | |
---|---|
Target Name | HDAC9 |
Gene Abbr. | HDAC9 |
Gene ID | 9734 |
Full Name | histone deacetylase 9 |
Alias | HD7, HD7b, HD9, HDAC, HDAC7 |
Species | Human |
Genomic Locus | chr7:18585376 |
Transcript | NM_001204146 |
WT Expression Level | 172.11 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of HDAC9. |
Description | 23bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AATTGCTTCTCACGGACAAC |
PCR Primer |
Forward: TTTCCAATCTTCTATTACCCTCCCC Reverse: AAGAGTCGGACATACTCAGAACATC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.