HDAC8 Knockout Cell Line - CD BioSciences

service-banner

HDAC8 Knockout Cell Line

HDAC8 Knockout Cell Line

SPL-01627

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name HDAC8
Gene Abbr. HDAC8
Gene ID 55869
Full Name histone deacetylase 8
Alias CDA07, CDLS5, HD8, HDACL1, KDAC8
Species Human
Genomic Locus chrX:72572730
Transcript NM_018486
WT Expression Level 39.28 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of HDAC8.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence CCACTGTCCGCCGGTTCCTC
PCR Primer Forward: AATTTCTGAAGATTTCCCCCAGCC
Reverse: TGAAATGGATGTGTTTGCAGATTGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.