HDAC6 Knockout Cell Line - CD BioSciences

service-banner

HDAC6 Knockout Cell Line

HDAC6 Knockout Cell Line

SPL-01620

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name HDAC6
Gene Abbr. HDAC6
Gene ID 10013
Full Name histone deacetylase 6
Alias CPBHM, HD6, JM21, PPP1R90
Species Human
Genomic Locus chrX:48802901
Transcript NM_006044
WT Expression Level 43.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It contains an internal duplication of two catalytic domains which appear to function independently of each other. This protein possesses histone deacetylase activity and represses transcription. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of HDAC6.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence GCTAGATTGGGGATAGAGCG
PCR Primer Forward: GAAAGAGAATCGTGTAAAAGGGGTG
Reverse: CATTTAACTGCTCATCCAACACCAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.