Online Inquiry
HDAC6 cDNA ORF Clone, Human, untagged
SPD-06358
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human histone deacetylase 6. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | HDAC6 |
| Gene Abbr. | HDAC6 |
| Gene ID | 10013 |
| Full Name | histone deacetylase 6 |
| Alias | CPBHM, HD6, JM21, PPP1R90 |
| Introduction | HDAC6 is a class II histone deacetylase enzyme localized to the cytoplasm and associated with the microtubule network. It is involved in the regulation of many cellular processes, including cell migration, immune synapse formation, viral infection, and degradation of misfolded proteins. HDAC6 contains two tandem catalytic domains that facilitate the deacetylation of multiple protein substrates, including histones and non-histone proteins such as tubulin, cortactin, and HSP90. Despite the ability to deacetylate histone proteins in vitro, there is no evidence for HDAC6-mediated deacetylation of histones in vivo. The acetylation/deacetylation of tubulin on Lys40 regulates binding and motility of the kinesin-1 motor protein and subsequent transport of cargo proteins such as JNK-interacting protein 1 (JIP1). The acetylation/deacetylation of cortactin regulates cell motility by modulating the binding of cortactin to F-actin. Acetylation/deacetylation of HSP90 modulates chaperone complex activity by regulating the binding of an essential cochaperone protein, p23. In addition to its role as a protein deacetylase, HDAC6 functions as a component of the aggresome, a proteinaceous inclusion body that forms in response to an accumulation of misfolded or partially denatured proteins. Formation of the aggresome is a protective response that sequesters cytotoxic protein aggregates for eventual autophagic clearance from the cell. HDAC6 contains a zinc finger ubiquitin-binding domain that binds both mono- and poly-ubiquitinated proteins. HDAC6 binds to both poly-ubiquitinated misfolded proteins and dynein motors, facilitating the transport of misfolded proteins to the aggresome. HDAC6 is also required for subsequent recruitment of the autophagic machinery and clearance of aggresomes from the cell. Thus, HDAC6 plays a key role in the protection against the deleterious effects of pathological protein aggregation that occurs in various diseases, such as neurodegenerative Huntington’s disease. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human histone deacetylase 6. |
| NCBI Ref Seq | BC069243.1 |
| RefSeq ORF Size | 3648 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + NotI (6.1kb + 3.65kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.