Online Inquiry
HDAC4 cDNA ORF Clone, Human, C-His tag
SPD-06353
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human histone deacetylase 4 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | HDAC4 |
| Gene Abbr. | HDAC4 |
| Gene ID | 9759 |
| Full Name | histone deacetylase 4 |
| Alias | AHO3, BDMR, HA6116, HD4, HDAC-4 |
| Introduction | Acetylation of the histone tail causes chromatin to adopt an "open" conformation, allowing increased accessibility of transcription factors to DNA. The identification of histone acetyltransferases (HATs) and their large multiprotein complexes has yielded important insights into how these enzymes regulate transcription. HAT complexes interact with sequence-specific activator proteins to target specific genes. In addition to histones, HATs can acetylate nonhistone proteins, suggesting multiple roles for these enzymes. In contrast, histone deacetylation promotes a "closed" chromatin conformation and typically leads to repression of gene activity. Mammalian histone deacetylases can be divided into three classes on the basis of their similarity to various yeast deacetylases. Class I proteins (HDACs 1, 2, 3, and 8) are related to the yeast Rpd3-like proteins, those in class II (HDACs 4, 5, 6, 7, 9, and 10) are related to yeast Hda1-like proteins, and class III proteins are related to the yeast protein Sir2. Inhibitors of HDAC activity are now being explored as potential therapeutic cancer agents.Histone deacetylases (HDACs) interact with an increasing number of transcription factors, including myocyte enhancer factor 2 (MEF2), to negatively regulate gene expression. HDACs are regulated in part by shuttling between the nucleus and cytoplasm, where export to the cytoplasm facilitates gene activation by removing HDACs from their target genes. The cytoplasmic export is facilitated by 14-3-3 proteins, which bind to specific phosphoserine residues on the HDAC proteins. These phosphoserine 14-3-3 binding modules are highly conserved between HDAC proteins, allowing for their collective regulation in response to specific cell stimuli. For example, the highly conserved HDAC4 Ser246, HDAC5 Ser259 and HDAC7 Ser155 residues are all phosphorylated by CAMK and PKD kinases in response to multiple cell stimuli, including VEGF-induced angiogenesis in endothelial cells, B cell and T cell activation, and differentiation of myoblasts into muscle fiber. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human histone deacetylase 4 |
| NCBI Ref Seq | NM_006037.3 |
| RefSeq ORF Size | 3300 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1269G/A,2565C/T not causing the amino acid variation. |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV mammalian cell promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | KpnI (two restriction sites) + XbaI (6kb + 2.87kb + 0.44kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.