Online Inquiry
HDAC3 Knockout Cell Line
SPL-01616
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | HDAC3 |
| Gene Abbr. | HDAC3 |
| Gene ID | 8841 |
| Full Name | histone deacetylase 3 |
| Alias | HD3, KDAC3, RPD3, RPD3-2 |
| Species | Human |
| Genomic Locus | chr5:141636556 |
| Transcript | NM_003883 |
| WT Expression Level | 70.25 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of HDAC3. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCTTATAGAGACCGTAATGC |
| PCR Primer |
Forward: GAAACAGGGATATGCATGAGGAGTT Reverse: CAAGGTACTCCTGGTGACTTCTATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.